18  viewing the fine grained password policy that is in effect for a user account

37  triển khai fine grained password policies

37 triển khai fine grained password policies

Ngày tải lên : 15/01/2014, 16:22
... password age (msDS-MaximumPasswordAge): tuổi thọ tối a password • Minimum password age (msDS-MinimumPasswordAge): tuổi thọ tối thiểu password • Minimum password length (msDS-MinimumPasswordLength): ... Container,CN=System,DC=bachkhoa-npower,DC=vn changetype: add objectClass: msDS-PasswordSettings msDS-MaximumPasswordAge:-1728000000000 msDS-MinimumPasswordAge:-864000000000 msDS-MinimumPasswordLength:5 msDS-PasswordHistoryLength:0 ... file để link đến user group định Bạn tạo nhiều file PSO file PSO bao gồm thông tin sau : • Enforce password history (msDS-PasswordHistoryLength) : số lần lưu giữ password • Maximum password age (msDS-MaximumPasswordAge):...
  • 19
  • 196
  • 0
Tài liệu Báo cáo khoa học: "Learning the Fine-Grained Information Status of Discourse Entities" pptx

Tài liệu Báo cáo khoa học: "Learning the Fine-Grained Information Status of Discourse Entities" pptx

Ngày tải lên : 22/02/2014, 03:20
... Computational Natural Language Learning: Shared Task, pages 28–34 Malvina Nissim, Shipra Dingare, Jean Carletta, and Mark Steedman 2004 An annotation scheme for information status in dialogue In ... et al (2004).3 Owing in part to the increase in the number of categories, finegrained IS determination is arguably a more challenging task than the 3-class IS determination task that Nissim and ... Switchboard dialogues Reporting results using these two ways of obtaining chains facilitates the comparison of the IS determination results that we can realistically obtain using existing coreference...
  • 10
  • 433
  • 0
Tài liệu Báo cáo khoa học: Aggregative organization enhances the DNA end-joining process that is mediated by DNA-dependent protein kinase pdf

Tài liệu Báo cáo khoa học: Aggregative organization enhances the DNA end-joining process that is mediated by DNA-dependent protein kinase pdf

Ngày tải lên : 19/02/2014, 06:20
... the protein kinase that is mutated in the human hereditary disease ataxia telangiectasia: induced chromatin alterations relay its intermolecular autophosphorylation and dimer dissociation [10] ... Aggregation-coupled DNA end-joining M Takahagi and K Tatsumi One hallmark of the initial response to DSBs is the rapid activation of ATM (product of the ataxia telangiectasia mutated gene), the ... the former motif and a part of the latter one abolished the ssDNA-specific aggregation activity (Fig 4) but remained a valid binding capacity to ssDNA (unpublished work) Therefore, the aggregation...
  • 13
  • 458
  • 0
the evolution of monetary policy and banking in the us (2008)

the evolution of monetary policy and banking in the us (2008)

Ngày tải lên : 30/10/2014, 17:01
... 0.96% The average rate of inflation was above 2% in calendar 1958 The Federal Reserve began to tighten again in 1958:2 in a renewed attack on inflation All of the principal indicators were signaling ... risk, and wealth in the U.S My interest in banks dates from my undergraduate days at Yale when I worked as a research assistant for James Tobin My dissertation on bank lending at Yale was partly ... individuals acquired stakes in foreign countries The relative emphasis on monetary and fiscal policy changed with the arrival of the Kennedy administration During the Eisenhower administration there...
  • 203
  • 299
  • 0
Báo cáo khoa học: The pH dependence of kinetic isotope effects in monoamine oxidase A indicates stabilization of the neutral amine in the enzyme–substrate complex ppt

Báo cáo khoa học: The pH dependence of kinetic isotope effects in monoamine oxidase A indicates stabilization of the neutral amine in the enzyme–substrate complex ppt

Ngày tải lên : 07/03/2014, 06:20
... following the decrease in A4 56 Data analysis Steady-state kinetic data were fitted with the Michaelis– Menten equation using nonlinear least-squares analysis incorporated into the origin software package ... purification of MAO A The gene encoding human liver MAO A was amplified from a cDNA clone obtained from MRC Geneservices (Cambridge, UK) using the primers 5¢-GTCTTCGAA ACCATGGAGAATCAAGAGAAGGCGAGTATCGCGG ... relative to the dissociation steps, so that they remain in thermodynamic equilibrium It can be seen that if the pKa of the amine substrate is increased (e.g in the deuterated analogue), this...
  • 9
  • 327
  • 0
Báo cáo khoa học: Analysis of the CK2-dependent phosphorylation of serine 13 in Cdc37 using a phospho-specific antibody and phospho-affinity gel electrophoresis doc

Báo cáo khoa học: Analysis of the CK2-dependent phosphorylation of serine 13 in Cdc37 using a phospho-specific antibody and phospho-affinity gel electrophoresis doc

Ngày tải lên : 30/03/2014, 03:20
... Koyasu S, Nishida E, Kadowaki T, Matsuzaki F, Iida K, Harada F, Kasuga M, Sakai H & Yahara I (1986) Two mammalian heat shock proteins, HSP90 and HSP100, are actin-binding proteins Proc Natl Acad ... activate a kinase By contrast, binding an activating regulatory coprotein to an inactive catalytic subunit can activate a kinase In many signal-transducing protein kinases, site-specific phosphorylation ... by an upstream protein kinase (a kinasekinase) activates them Before these activation steps, the protein kinases must be in the correct structural conformation, to be activated by the appropriate...
  • 14
  • 342
  • 0
The Project Gutenberg EBook of Short Cuts in Figures, by A. Frederick Collins pdf

The Project Gutenberg EBook of Short Cuts in Figures, by A. Frederick Collins pdf

Ngày tải lên : 28/06/2014, 19:20
... found and these are (1) the taking-away, or complement method, and (2) the making-up, or making-change method, as these methods are variously called The Taking-Away Method. In the taking-away or ... paid a creditor for the time that the principal remains unpaid and is usually calculated on a yearly basis, a year being taken to have 12 months, of 30 days each, or 360 days Compound interest is ... have a clear idea of what arithmetic is and of the ordinary methods used in calculation To begin with arithmetic means that we take certain numbers we already know about, that is the value of, and...
  • 95
  • 383
  • 0
Báo cáo lâm nghiệp: "The route of the pollen tube from stigma to ovule in Populus nigra : a new look" docx

Báo cáo lâm nghiệp: "The route of the pollen tube from stigma to ovule in Populus nigra : a new look" docx

Ngày tải lên : 09/08/2014, 06:22
... the XVllth Session of the international Poplar commission, Ottawa, Canada, 25-30 ON T m AM H l D., 1976 Inter,!ectional incompatibility in Populus PhD thesis, Australian Nation3 Univ Canberra, ... to a cryogenic preparation system After rapid freezing, fresh pistil samples are fractured at low temperature before observation The visualization of the pollen tube progress in this cavity has ... grain adhesion, hydration and germination on a P nigra stigmatic surface is observed in figure Pollen tubes penetrate the stigma, grow through the stigmatic lobes and join together within the...
  • 6
  • 310
  • 0
Báo cáo y học: "An exploration of how clinician attitudes and beliefs influence the implementation of lifestyle risk factor management in primary healthcare: a grounded theory study" pot

Báo cáo y học: "An exploration of how clinician attitudes and beliefs influence the implementation of lifestyle risk factor management in primary healthcare: a grounded theory study" pot

Ngày tải lên : 11/08/2014, 05:21
... Valois P, Desharnais R, Godin G: A comparison of the Fishbein and Ajzen and the Triandis attitudinal models for the prediction of exercise intention and behavior Journal of Behavioral Medicine ... practices from baseline to post-intervention 1Low defined as scores in the clinician risk factor survey in the lowest quartile for those participating in an interview defined as scores in the ... intentions appeared to act as a cognitive framework or mindset shaping clinicians' intervention practices Risk factor management practices Clinicians' risk factor management practices varied according...
  • 15
  • 708
  • 0
báo cáo khoa học: " The growing caseload of chronic life-long conditions calls for a move towards full selfmanagement in low-income countries" ppsx

báo cáo khoa học: " The growing caseload of chronic life-long conditions calls for a move towards full selfmanagement in low-income countries" ppsx

Ngày tải lên : 11/08/2014, 14:21
... general malaise of health systems such as a maldistribution of adequately trained and well-motivated staff and a lack of affordable and reliable drugs and diagnostics [45] The poor quality of care ... Glassman A, Gaziano T, Bouillon Buendia C, Guanais de Aguiar F: Confronting the chronic disease burden in latin america and the Caribbean Health Aff 2010, 29:2142-2148 18 World Health Organisation: Innovative ... caregivers and families, by information and communication tools, by medication and technology and by professionals for specialised advice, information, certain tests and diagnosis This is intended as the...
  • 10
  • 419
  • 0
Báo cáo y học: "The relaxation exercise and social support trialresst: study protocol for a randomized community based trial" potx

Báo cáo y học: "The relaxation exercise and social support trialresst: study protocol for a randomized community based trial" potx

Ngày tải lên : 11/08/2014, 15:22
... gynaecological symptoms, such as pelvic pain and abnormal vaginal discharge [5,12,14-22] Taking the already discussed UHS, the sub-sample analysis pertaining to Hey el Selloum sample, showed that ... Kaaya SF, Fawzi MC, Mbwambo JK, Lee B, Msamanga GI, Fawzi W: Validity of the Hopkins Symptom Checklist-25 amongst HIV-positive pregnant women in Tanzania Acta Psychiatrica Scandinavica Information ... throughout the different stages of the trial: preparation, recruitment, training on intervention and data collection, as well data analysis, data reporting and dissemination Two committees that are...
  • 8
  • 569
  • 0
Báo cáo y học: "The SLC2A9 non-synonymous Arg265His variant and gout; evidence for a population-specific effect on severit" docx

Báo cáo y học: "The SLC2A9 non-synonymous Arg265His variant and gout; evidence for a population-specific effect on severit" docx

Ngày tải lên : 12/08/2014, 15:23
... Black is thanked for his assistance with statistical analysis The Framingham Heart Study and the Framingham SHARe project are conducted and supported by the National Heart, Lung, and Blood Institute ... set as unknown) Gender and gender-genotype interaction analysis was performed using STATA Metaanalysis was performed to combine data from independent datasets using Rmeta software (within STATA) ... peoples is warranted These populations have shared geographical history, although it is increasingly evident that considerable genetic heterogeneity exists within Asia and Austronesian, at least in...
  • 25
  • 266
  • 0
Where is the energy spent inside my app? Fine Grained Energy Accounting on Smartphones with Eprof pot

Where is the energy spent inside my app? Fine Grained Energy Accounting on Smartphones with Eprof pot

Ngày tải lên : 29/03/2014, 14:20
... runs the third-party Flurry [7] program as a separate thread for data aggregation and advertisement.) Finally, per-process accounting is relevant as all new smartphone OSes support multitasking and ... for each instance the component spends in the tail state, we annotate the tail state with the routines called by the app during that period, including routines that use other components, usually ... trigger Finally, we argue this last “misinforming” problem exists no matter what accounting policy is used Hence ultimately, for an accounting tool to be informative to the developer, the profiling output...
  • 14
  • 840
  • 0
báo cáo khoa học: " Evidence-informed health policy 1 – Synthesis of findings from a multi-method study of organizations that support the use of research evidence" pptx

báo cáo khoa học: " Evidence-informed health policy 1 – Synthesis of findings from a multi-method study of organizations that support the use of research evidence" pptx

Ngày tải lên : 11/08/2014, 16:21
... knowledge is generated and ways in which it is used, including the transformation of health-research findings into policy and practice.' Organizations have already been established in many countries and ... the quantitative data, and drafted the article and the report in which it is based AO conceived of the study, led its design and coordination, participated in analyzing the qualitative data, and ... was to support local adaptation efforts This advice is supported by: 1) the (qualitative) survey finding that some CPG- and HTA-producing organizations argued that WHO should play a facilitating...
  • 7
  • 261
  • 0